sequence scramble online tool  (GenScript corporation)

Journal: The FASEB Journal

Article Title: MS 275 Inhibits Neuroblastoma Cell Growth by Mediating H 3 K 27ac/ PROX 1 Axis In Silico and In Vitro

doi: 10.1096/fj.202500464RR

Figure Lengend Snippet: PROX1 is essential for MS275 induced cell cycle arrest and apoptosis. Stable cell lines shNC, shPROX1‐3, and shPROX1‐5 were cultured in 6 wells and grouped as Figure . After 48‐h treatment of 10 μM MS275, cells were harvested for cell cycle and apoptosis analysis using flow cytometry. (A) Flow cytometry plot of cell cycle assays. (B) Statistical analysis of cell cycle distribution. Each experiment was repeated at least three times independently. Compared to the shNC group, * p < 0.05; **** p < 0.0001; compared to the shNC + 10 μM MS275 group, ## p < 0.01; ### p < 0.001. (C) PI single staining to detect apoptosis. GFP indicated stable transfectants, and PI single staining indicated cell death. (D) Statistical analysis of apoptotic cells. Each experiment was repeated at least three times independently. Compared to the shNC group, **** p < 0.0001; compared to the shNC + 10 μM MS275 group, #### p < 0.0001.

Article Snippet: For the lentivirus‐mediated RNA interference targeting PROX1expression, three specific short hairpin RNAs (shRNAs) against PROX1, namely, shPROX1‐3 (target sequence: GCTCTGAACATGCACTACAAT), shPROX1‐4 (target sequence: CCGACGTAAAGTTCAACAGAT), and shPROX1‐5 (target sequence: CCCGAGAAAGTTACAGAGAAA) along with a scrambled shRNA sequence tagged with GFP, serving as a negative control (shNC), were purchased from Genechem (Shanghai, China).

Techniques: Stable Transfection, Cell Culture, Flow Cytometry, Staining